Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3701727
End position: 3701750
Length: 24

DNA sequence
>NC_002927, from 3701727 to 3701750 (24 bp); Bordetella bronchiseptica ACCGCCACCACCTCCGCCACCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3701160-3701960	Sequence	BB3457 etfB electron transfer flavoprotein subunit beta (Protein is coded in complementary strand; from 3701960 to 3701160)