Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3665322
End position: 3665345
Length: 24

DNA sequence
>NC_002927, from 3665322 to 3665345 (24 bp); Bordetella bronchiseptica CCGCCAGCGCCACGGCCACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3663662-3666193	Sequence	BB3420 - inner membrane transport permease (Protein is coded in complementary strand; from 3666193 to 3663662)