Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3531232
End position: 3531255
Length: 24

DNA sequence
>NC_002927, from 3531232 to 3531255 (24 bp); Bordetella bronchiseptica CCAGCGCCAGCATCAGCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3530691-3531596	Sequence	BB3300 - RNA polymerase sigma factor SigJ (Protein is coded in complementary strand; from 3531596 to 3530691)