Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3242252
End position: 3242275
Length: 24

DNA sequence
>NC_002927, from 3242252 to 3242275 (24 bp); Bordetella bronchiseptica TGCGCCTGCTCCAGCGCCAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3241829-3242335	Sequence	BB3037 cumB zinc-binding hydrolase (Protein is coded in complementary strand; from 3242335 to 3241829)