Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3220357
End position: 3220380
Length: 24

DNA sequence
>NC_002927, from 3220357 to 3220380 (24 bp); Bordetella bronchiseptica CACGCCCACGTCCAGGCCGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3219935-3220684	Sequence	BB3015 - hypothetical protein (Protein is coded in complementary strand; from 3220684 to 3219935)