Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2858591
End position: 2858614
Length: 24

DNA sequence
>NC_002927, from 2858591 to 2858614 (24 bp); Bordetella bronchiseptica GGCGCGCCGGCGCGCGGGCGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2857454-2859694	Sequence	BB2694 dmfA2 large subunit of N,N-dimethylformamidase (Protein is coded in complementary strand; from 2859694 to 2857454)