Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2591807
End position: 2591830
Length: 24

DNA sequence
>NC_002927, from 2591807 to 2591830 (24 bp); Bordetella bronchiseptica GCGGCGCGGCAGCGCGGCGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2591010-2591972	Sequence	BB2438 - 3-hydroxybutyryl-CoA dehydrogenase (Protein is coded in complementary strand; from 2591972 to 2591010)