Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2559479
End position: 2559502
Length: 24

DNA sequence
>NC_002927, from 2559479 to 2559502 (24 bp); Bordetella bronchiseptica AGCAGGGGCAGGATCAGGGGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2559119-2559577	Sequence	BB2404 - hypothetical protein (Protein is coded in complementary strand; from 2559577 to 2559119)