Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2557096
End position: 2557119
Length: 24

DNA sequence
>NC_002927, from 2557096 to 2557119 (24 bp); Bordetella bronchiseptica CCAGCAGCAGCACCATCAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2556450-2558141	Sequence	BB2402 - sulfate transporter (Protein is coded in complementary strand; from 2558141 to 2556450)