Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2538019
End position: 2538042
Length: 24

DNA sequence
>NC_002927, from 2538019 to 2538042 (24 bp); Bordetella bronchiseptica CGCGGCCGTGGCCGCGGGCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2537213-2538973	Sequence	BB2382 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 2538973 to 2537213)