Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2477016
End position: 2477039
Length: 24

DNA sequence
>NC_002927, from 2477016 to 2477039 (24 bp); Bordetella bronchiseptica GGCTCGGCCTCGGCCTCGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2476647-2477258	Sequence	BB2325 - hypothetical protein (Protein is coded in complementary strand; from 2477258 to 2476647)