Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 234805
End position: 234828
Length: 24

DNA sequence
>NC_002927, from 234805 to 234828 (24 bp); Bordetella bronchiseptica CAGGATCAGGAACGGGATCAGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 233918-234982	Sequence	BB0230 - branched-chain amino acid transport system permease (Protein is coded in complementary strand; from 234982 to 233918)