Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2331089
End position: 2331112
Length: 24

DNA sequence
>NC_002927, from 2331089 to 2331112 (24 bp); Bordetella bronchiseptica CCGCGCGACGCGCGCCGCGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2330285-2332210	Sequence	BB2180 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 2332210 to 2330285)