Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1987030
End position: 1987053
Length: 24

DNA sequence
>NC_002927, from 1987030 to 1987053 (24 bp); Bordetella bronchiseptica TCGCCGTCGGCGCCGCCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1986538-1987269	Sequence	BB1871 - hypothetical protein (Protein is coded in complementary strand; from 1987269 to 1986538)