Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 1000725
End position: 1000748
Length: 24

DNA sequence
>NC_002927, from 1000725 to 1000748 (24 bp); Bordetella bronchiseptica GGCCCAGGCGCAGGCGCAGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 999929-1002217	Sequence	BB0926 maeB malic enzyme (Protein is coded in complementary strand; from 1002217 to 999929)