Sequence retrieval

Genome: Escherichia coli O157:H7 str. Sakai
Start position: 5426060
End position: 5426109
Length: 50

DNA sequence
>NC_002695, from 5426060 to 5426109 (50 bp); Escherichia coli O157:H7 str. Sakai TATCTTTATCTTTATCTTTATCTTTATCTTTATCTTTATCTTTATCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5424265-5426472	Sequence	ECs5295 - hypothetical protein (Protein is coded in complementary strand; from 5426472 to 5424265)