Sequence retrieval

Genome: Escherichia coli O157:H7 str. Sakai
Start position: 861596
End position: 861640
Length: 45

DNA sequence
>NC_002695, from 861596 to 861640 (45 bp); Escherichia coli O157:H7 str. Sakai TGCAAAAGCAGCAGCTGAAAAAGCCGCTGCAGCAAAAGCTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 860848-862032	Sequence	ECs0774 tolA cell envelope integrity inner membrane protein TolA