Sequence retrieval

Genome: Escherichia coli O157:H7 str. Sakai
Start position: 4432481
End position: 4432516
Length: 36

DNA sequence
>NC_002695, from 4432481 to 4432516 (36 bp); Escherichia coli O157:H7 str. Sakai CCGCCAGCACCGCCAGCACCGCCAGCACCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4432396-4434753	Sequence	ECs4412 - cellulose synthase regulator protein (Protein is coded in complementary strand; from 4434753 to 4432396)