Sequence retrieval

Genome: Escherichia coli O157:H7 str. Sakai
Start position: 4781563
End position: 4781592
Length: 30

DNA sequence
>NC_002695, from 4781563 to 4781592 (30 bp); Escherichia coli O157:H7 str. Sakai CGGTGCAGGTGCAGGTGCAGGTGCAGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4781525-4782724	Sequence	ECs4733 - uroporphyrinogen III C-methyltransferase (Protein is coded in complementary strand; from 4782724 to 4781525)