Sequence retrieval

Genome: Escherichia coli O157:H7 str. Sakai
Start position: 2212141
End position: 2212169
Length: 29

DNA sequence
>NC_002695, from 2212141 to 2212169 (29 bp); Escherichia coli O157:H7 str. Sakai GGGCCTGCCGGGCCTGCCGGGCCTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2211826-2213049	Sequence	ECs2231 - tail fiber protein (Protein is coded in complementary strand; from 2213049 to 2211826)