Sequence retrieval

Genome: Escherichia coli O157:H7 str. Sakai
Start position: 1236502
End position: 1236525
Length: 24

DNA sequence
>NC_002695, from 1236502 to 1236525 (24 bp); Escherichia coli O157:H7 str. Sakai ATTGGGATTGTGATTGGCATTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1236437-1237609	Sequence	ECs1151 - trimethylamine N-oxide reductase cytochrome c-type subunit