Sequence retrieval

Genome: Bacillus halodurans
Start position: 3693667
End position: 3693691
Length: 25

DNA sequence
>NC_002570, from 3693667 to 3693691 (25 bp); Bacillus halodurans CAAAGTTAAAGTCAAGGTCAAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3692844-3693938	Sequence	BH3593 - hypothetical protein (Protein is coded in complementary strand; from 3693938 to 3692844)