Sequence retrieval

Genome: Bacillus halodurans
Start position: 3583433
End position: 3583467
Length: 35

DNA sequence
>NC_002570, from 3583433 to 3583467 (35 bp); Bacillus halodurans GTTTTGACCGTTTTGACCGTTTTGACCGTTTTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3583398-3583859	Sequence	BH3473 - hypothetical protein (Protein is coded in complementary strand; from 3583859 to 3583398)