Sequence retrieval

Genome: Bacillus halodurans
Start position: 2995782
End position: 2995809
Length: 28

DNA sequence
>NC_002570, from 2995782 to 2995809 (28 bp); Bacillus halodurans GTTGCTCTGGTTGCTCAGGTTGTTCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2995298-2996071	Sequence	BH2878 - hypothetical protein (Protein is coded in complementary strand; from 2996071 to 2995298)