Sequence retrieval

Genome: Bacillus halodurans
Start position: 2621984
End position: 2622011
Length: 28

DNA sequence
>NC_002570, from 2621984 to 2622011 (28 bp); Bacillus halodurans TGCGGCTGCTGCGGTTGCTGCGGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2621753-2623747	Sequence	BH2504 - serine/threonine protein kinase (Protein is coded in complementary strand; from 2623747 to 2621753)