Sequence retrieval

Genome: Bacillus halodurans
Start position: 2516297
End position: 2516327
Length: 31

DNA sequence
>NC_002570, from 2516297 to 2516327 (31 bp); Bacillus halodurans GCGTTTTTCTTAGTTTTTCTGCGTTTTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2514976-2517345	Sequence	BH2395 spoIIIE hypothetical protein (Protein is coded in complementary strand; from 2517345 to 2514976)