Sequence retrieval

Genome: Bacillus halodurans
Start position: 1778068
End position: 1778091
Length: 24

DNA sequence
>NC_002570, from 1778068 to 1778091 (24 bp); Bacillus halodurans ATTTCCATTGCCATTGCCATTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1777946-1780606	Sequence	BH1702 ponA penicillin-binding proteins 1A/1B (Protein is coded in complementary strand; from 1780606 to 1777946)