Sequence retrieval

Genome: Bacillus halodurans
Start position: 3002147
End position: 3002184
Length: 38

DNA sequence
>NC_002570, from 3002147 to 3002184 (38 bp); Bacillus halodurans GGACCAAAATTTGGACCGTAATTTGGGCCAAAATTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3002102-3002356	Sequence	BH2885 - hypothetical protein (Protein is coded in complementary strand; from 3002356 to 3002102)