Sequence retrieval

Genome: Ureaplasma urealyticum
Start position: 655687
End position: 655710
Length: 24

DNA sequence
>NC_002162, from 655687 to 655710 (24 bp); Ureaplasma urealyticum TTTATTTTTAGTTTTATTTATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 653483-656398	Sequence	UU527 - hypothetical protein (Protein is coded in complementary strand; from 656398 to 653483)