Sequence retrieval

Genome: Ureaplasma urealyticum
Start position: 585956
End position: 585979
Length: 24

DNA sequence
>NC_002162, from 585956 to 585979 (24 bp); Ureaplasma urealyticum AAAATAAAGATAAAAATTAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 585101-588112	Sequence	UU489 - membrane lipoprotein (Protein is coded in complementary strand; from 588112 to 585101)