Sequence retrieval

Genome: Ureaplasma urealyticum
Start position: 426443
End position: 426466
Length: 24

DNA sequence
>NC_002162, from 426443 to 426466 (24 bp); Ureaplasma urealyticum CTTTTTCTTTTGCTTCTTCTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 425870-426493	Sequence	UU372 tnp-1 integrase-recombinase (Protein is coded in complementary strand; from 426493 to 425870)