Sequence retrieval

Genome: Ureaplasma urealyticum
Start position: 406213
End position: 406240
Length: 28

DNA sequence
>NC_002162, from 406213 to 406240 (28 bp); Ureaplasma urealyticum TTTGTATTTTTTGTATCTATTGTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 405290-406360	Sequence	UU357 fecD citrate-dependent iron transport, membrane-bound protein