Sequence retrieval

Genome: Ureaplasma urealyticum
Start position: 253768
End position: 253797
Length: 30

DNA sequence
>NC_002162, from 253768 to 253797 (30 bp); Ureaplasma urealyticum TTTTATTGTATTATATATTAATTTATTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 253523-254161	Sequence	UU209 - hypothetical protein (Protein is coded in complementary strand; from 254161 to 253523)