Sequence retrieval

Genome: Ureaplasma urealyticum
Start position: 201442
End position: 201468
Length: 27

DNA sequence
>NC_002162, from 201442 to 201468 (27 bp); Ureaplasma urealyticum CATTTTCTTTATTTTCTTCAGTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 201180-201506	Sequence	UU165 - hypothetical protein (Protein is coded in complementary strand; from 201506 to 201180)