Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 771811
End position: 771834
Length: 24

DNA sequence
>NC_001318, from 771811 to 771834 (24 bp); Borrelia burgdorferi TTTCATCTTCATTTTTATTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 771570-774368	Sequence	BB_0732 - penicillin-binding protein (Protein is coded in complementary strand; from 774368 to 771570)