Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 769541
End position: 769574
Length: 34

DNA sequence
>NC_001318, from 769541 to 769574 (34 bp); Borrelia burgdorferi TTGTTTTAAAATTTTTTTAGAATTTTTTTAGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 769547-771139	Sequence	BB_0730 pgi glucose-6-phosphate isomerase (Protein is coded in complementary strand; from 771139 to 769547)