Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 741599
End position: 741623
Length: 25

DNA sequence
>NC_001318, from 741599 to 741623 (25 bp); Borrelia burgdorferi TTTTTTTCTTTTTATGTTTTTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 741396-742628	Sequence	BB_0706 - polynucleotide adenylyltransferase (Protein is coded in complementary strand; from 742628 to 741396)