Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 652004
End position: 652030
Length: 27

DNA sequence
>NC_001318, from 652004 to 652030 (27 bp); Borrelia burgdorferi CTTTTATTTCTTTTATTGCTCTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 650413-653790	Sequence	BB_0623 mfd transcription-repair coupling factor (Protein is coded in complementary strand; from 653790 to 650413)