Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 38027
End position: 38051
Length: 25

DNA sequence
>NC_001318, from 38027 to 38051 (25 bp); Borrelia burgdorferi AAAAAAAAAGAATAAAAACAAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 36606-38123	Sequence	BB_0038 - hypothetical protein (Protein is coded in complementary strand; from 38123 to 36606)