Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 340164
End position: 340191
Length: 28

DNA sequence
>NC_001318, from 340164 to 340191 (28 bp); Borrelia burgdorferi AAATAAAAAATTAAAAACAAAAAATACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 340062-340217	Sequence	BB_0331 - hypothetical protein (Protein is coded in complementary strand; from 340217 to 340062)