Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 330707
End position: 330739
Length: 33

DNA sequence
>NC_001318, from 330707 to 330739 (33 bp); Borrelia burgdorferi AAACAAATAAAAACTAATAAAAAGAAATAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 329643-330752	Sequence	BB_0325 - hypothetical protein (Protein is coded in complementary strand; from 330752 to 329643)