Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 272585
End position: 272609
Length: 25

DNA sequence
>NC_001318, from 272585 to 272609 (25 bp); Borrelia burgdorferi AAAAATAAAAAAAGAAAAAGAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 270488-272641	Sequence	BB_0259 - transglycosylase SLT domain-containing protein (Protein is coded in complementary strand; from 272641 to 270488)