Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 170722
End position: 170746
Length: 25

DNA sequence
>NC_001318, from 170722 to 170746 (25 bp); Borrelia burgdorferi TCTTTTGTTCTTTTTTTCTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 170720-171097	Sequence	BB_0168 - dnaK suppressor (Protein is coded in complementary strand; from 171097 to 170720)