Sequence retrieval

Genome: Borrelia burgdorferi
Start position: 142864
End position: 142888
Length: 25

DNA sequence
>NC_001318, from 142864 to 142888 (25 bp); Borrelia burgdorferi ACTAAAACTAAGAATAAAACTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 141979-142932	Sequence	BB_0141 - membrane fusion protein (Protein is coded in complementary strand; from 142932 to 141979)