Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 992797
End position: 992820
Length: 24

DNA sequence
>NC_001263, from 992797 to 992820 (24 bp); Deinococcus radiodurans R1 ACTTCGAGTTCGGCTTCGATTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 991972-993099	Sequence	DR_0976 prfA peptide chain release factor 1 (Protein is coded in complementary strand; from 993099 to 991972)