Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 941651
End position: 941678
Length: 28

DNA sequence
>NC_001263, from 941651 to 941678 (28 bp); Deinococcus radiodurans R1 AGCAGCGGCAGCACCAGCAGCGGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 940535-941752	Sequence	DR_0926 - sodium extrusion protein NatB (Protein is coded in complementary strand; from 941752 to 940535)