Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 855695
End position: 855719
Length: 25

DNA sequence
>NC_001263, from 855695 to 855719 (25 bp); Deinococcus radiodurans R1 GTGGGTGTCGGTGTAGGTGTGGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 855012-855914	Sequence	DR_0843 - hypothetical protein (Protein is coded in complementary strand; from 855914 to 855012)