Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 567505
End position: 567550
Length: 46

DNA sequence
>NC_001263, from 567505 to 567550 (46 bp); Deinococcus radiodurans R1 GCCCACCCCACCATGCCCACCCCAGCATGCCCGGCCCACCATGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 566403-567533	Sequence	DR_0560 - hypothetical protein (Protein is coded in complementary strand; from 567533 to 566403)