Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 563098
End position: 563144
Length: 47

DNA sequence
>NC_001263, from 563098 to 563144 (47 bp); Deinococcus radiodurans R1 CTGCCCAGTAACGCCCAGCCCAGTAACGCCCAGCCCGGTGACGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 562484-563317	Sequence	DR_0557 - hypothetical protein (Protein is coded in complementary strand; from 563317 to 562484)