Sequence retrieval

Genome: Deinococcus radiodurans R1
Start position: 553134
End position: 553181
Length: 48

DNA sequence
>NC_001263, from 553134 to 553181 (48 bp); Deinococcus radiodurans R1 CTGCCGGTACCAGTGCCGGTGCCAGTGCCGGTACCAGTGCCGGTACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 553128-554072	Sequence	DR_0548 - pilin, type IV (Protein is coded in complementary strand; from 554072 to 553128)